▶ 실험 과정
(A) 1차 PCR 프라이머 디자인
| 1st Forward primer |
GAGCTCGAAAACTTATATTTTCAGGGC
+ 21 mer from the target gene's 5' end |
| 1st Reverse primer |
GGGCTTTGTTAGCAGCCGGTCGACCTA
+ 21 mer from the target gene's 3' gene in reverse complimentary sequence |
예시) Control DNA, control primer sets
(B) Template 제작
Template DNA 제작 과정은 두 번의 PCR 반응으로 진행됩니다.
1) 1차 PCR: 카세트의 일부 서열을 포함하는 extended primer(주문제작)을 이용하여 목적 유전자를 증폭합니다.
2) 2차 PCR: 1차 PCR 산물과 원하는 카세트를 첨가하여 overlapping PCR을 수행하면, 단백질 발현용 template DNA를 제작할 수 있습니다.
▶ 실험 자료
1) Control DNA (18 kDa)
Figure1. Template DNA construction and protein synthesis data for the control DNA.
Each linear template DNA was generated by using ExiProgen™ Protein Expression Optimization Kit.
The linear template DNA was used as templates for protein synthesis with our various protein synthesis kits. Length of the control DNA is 462 bp and molecular weight of the control protein is 18 kDa.
Data (A): 2nd PCR product using the 1% agarose gel image.
Data (B), (C), (D): Each protein was synthesized using 1 µg of DNA and 22.5 µL of the purified protein was loaded on 12% SDS-PAGE gel.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.
2) Synthesis of difficult-to-express proteins
Figure2. Protein synthesis data of various sizes of difficult-to-express proteins.
Difficult-to-express proteins were synthesized using the template DNAs generated by the tag screening kit and ExiProgen™ EC Protein Synthesis Kit.
Data (A-F): Synthesized proteins analyzed by SDS-PAGE.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.
▶ 바이오니아 ExiProgen™ 을 이용한 논문 리스트
| 발행연도 |
논문 제목 |
저자 |
논문 정보 |
| 2018 |
Highly efficient genome editing by CRISPR-Cpf1 using CRISPR RNA with a uridinylate-rich 3′-overhang |
Bin Moon S, Lee JM, Kang JG, Lee NE, Ha DI, Kim DY, Kim SH, Yoo K, Kim D, Ko JH, Kim YS |
Nat Commun. 2018 Sep 7;9(1):3651. |
| 2018 |
Receptor-mediated dimerization of JAK2 FERM domains is required for JAK2 activation. |
Ryan D Ferrao, Heidi JA Wallweber, Patrick J Lupardus |
Elife. 2018 Jul 25;7. |
| 2018 |
Selectively Modulating Conformational States of USP7 Catalytic Domain for Activation. |
Özen A, Rougé L, Bashore C, Hearn BR, Skelton NJ, Dueber EC |
Structure. 2018 Jan 2;26(1):72-84. |
| 2016 |
The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress. |
Lee A, Lee SS, Jung WY, Park HJ, Lim BR6 Kim HS, Ahn JC, Cho HS |
Int J Mol Sci. 2016 Jul 19;17(7). |
| 2016 |
The role of MscL amphipathic N terminus indicates a blueprint for bilayer-mediated gating of mechanosensitive channels. |
Bavi N, Cortes DM, Cox CD, Rohde PR, Liu W, Deitmer JW, Bavi O, Strop P, Hill AP, Rees D, Corry B, Perozo E, Martinac B |
Nat Commun. 2016 Jun 22;7:11984. |
| 2016 |
Removal of the mechanoprotective influence of the cytoskeleton reveals PIEZO1 is gated by bilayer tension. |
Cox CD, Bae C, Ziegler L, Hartley S, Nikolova-Krstevski V, Rohde PR, Ng CA, Sachs F, Gottlieb PA, Martinac B |
Nat Commun. 2016 Jan 20;7:10366. |
| 2016 |
Overexpression of OsCYP19-4 increases tolerance to cold stress and enhances grain yield in rice (Oryza sativa L.) |
Yoon DH, Lee SS, Park HJ, Lyu JI, Chong WS, Liu JR, Kim BG, Ahn JC, Cho HS |
J Exp Bot. 2016 Jan;67(1):69-82. |
| 2015 |
Development of a Recombinant Protein Vaccine Based on Cell-Free Protein Synthesis for Sevenband Grouper Epinephelus septemfasciatus Against Viral Nervous Necrosis. |
Kim JO, Kim JO, Kim WS, Oh MJ |
J Microbiol Biotechnol. 2015 Oct;25(10):1761-7. |
바이오니아의 재조합단백질 합성 및 정제에 관련된 제품군은 아래와 같이 분류되며, 용도에 따라서 선택이 가능합니다.
Exiprogen™ 데모 신청은 sales@bioneer.co.kr 로 문의하여 주시기 바랍니다.
| 과정 |
제품 종류 |
사용 장비 |
서비스 |
|
DNA Template
준비
|
 |
 |
 |
|
단백질
합성 / 정제 / 투석
|
 |
|
|
